Description

Chapter: 15 -Problem: 2 >> You have genetically engineered green fluorescent protein (GFP) containing a KDEL sequence. When the construct is transfected into normal human fibroblasts and examined using fluorescence microscopy, the fluorescence appears throughout the cytoplasm, as drawn below. a. How would you explain this pattern given that KDEL is supposed to be an ER-specific sorting sequence?b. To analyze the results fur
Answer Preview: a Its everywhere because GFP is not a secreted protein so it wouldnt have a hydrophob…

, Chapter: 13 -Problem: 6 >> Temperature-sensitive yeast mutants have been isolated that block each of the enzymatic steps in the synthesis of the dolichol-oligosaccharide precursor for N-linked glycosylation. Propose an explanation for why mutations that block synthesis of the intermediate with the structure dolichol-PP-(GlcNAc)2Man5 completely prevent addition of N-linked oligosaccharide chains to secretory proteins, wherea
Answer Preview: The seven sugar intermediate is synthesized by sugar addition to cytosolicfacing dolichol phosp…

, Chapter: 13 -Problem: 14 >> Why is localization of Ran-GAP in the nucleus and Ran-GEF in the cytoplasm necessary for unidirectional transport of cargo proteins containing an NES?
Answer Preview: Ran guanine nucleotide exchange factor Ran GEF must be present in the …

, Chapter: 14 -Problem: 8 >> Sorting signals that cause retrograde transport of a protein in the secretory pathway are sometimes known as retrieval sequences. List the two known examples of retrieval sequences for soluble and membrane proteins of the ER. How does the presence of a retrieval sequence on a soluble ER protein result in its retrieval from the cis-Golgi complex? Describe how the concept of a retrieval sequence is
Answer Preview: Lys Asp Glu Leu KDEL and Lys Lys X X KKXX are both retrieval sequences for ER protei…

, Chapter: 22 -Problem: 11 >> Describe the mechanism of action for addictive drugs such as cocaine.
Answer Preview: Under normal circumstances leftover neurotransmitters released into …

, Chapter: 13 -Problem: 7 >> Name four different proteins that facilitate the modification and/or folding of secretory proteins within the lumen of the ER. Indicate which of these proteins covalently modifies substrate proteins and which brings about only conformational changes in substrate proteins.
Answer Preview: Several proteins facilitate the modfication or folding of secr…

, Chapter: 21 -Problem: 16 >> Predict the effects of the following mutations on the ability of a cell to undergo apoptosis:a. Mutation in Bad such that it cannot be phosphorylated by protein kinase B (PKB)b. Over expression of Bcl-2c. Mutation in Bax such that it cannot form homodimers One common characteristic of cancer cells is a loss of function in the apoptotic pathway. Which of the mutations listed above might you expect
Answer Preview: a The cell should undergo apoptosis even in the presence of trophic factors b …

, Chapter: 15 -Problem: 11 >> Which of the following steps amplify the epinephrine signal response in cells: receptor activation of G protein, G protein activation of adenylyl cyclase (AC), cAMP activation of PKA, or PKA phosphorylation of glycogen phosphorylase kinase (GPK)? Which change will have a greater effect on signal amplification: an increase in the number of epinephrine receptors or an increase in the number of Gas p
Answer Preview: Steps at which a single active component activates multiple targets amplify the si…

, Chapter: 15 -Problem: 9 >> Signal-transducing trimeric G proteins consist of three subunits designated ?, ? and '?· The Ga subunit is a GTPase switch protein that cycles between active and inactive states depending on whether it is bound to GTP or to GDP. Review the steps for ligand-induced activation of effector proteins mediated by the trimeric G proteins. Suppose that you have isolated a mutant Ga subunit that has an inc
Answer Preview: For trimeric G proteins in the inactive state Gas is bound to GDP and comple…

, Chapter: 15 -Problem: 5 >> Signaling by soluble extracellular molecules can be classified as endocrine, paracrine, or autocrine. Describe how these three types of cellular signaling differ. Growth hormone is secreted from the pituitary, which is located at the base of the brain and acts through growth hormone receptors located on the liver. Is this an example of endocrine, paracrine, or aurocrine signaling? Why?
Answer Preview: Endocrine paracrine and autocrine signaling differ according to the di…

, Chapter: 13 -Problem: 17 >> Antibody labeling of proteins like that used in immune-fluorescence analysis can be applied to electron microscopy, but instead of using fluorescent labels attached to antibodies, investigators use gold particles that are electron dense and appear as uniform dots in an electron micrograph. Furthermore, by varying the size of the gold particles (e.g., 5 nm vs 10 nm), one can identify the localizati
Answer Preview: a The smaller sized gold particles are labeled Tim44 i inner and the larger particles Tom40 o outer …

, Chapter: 21 -Problem: 14 >> Based on your understanding of the events surrounding cell death, predict the effect(s) of the following on the ability of a cell to undergo apoptosis:a. Functional CED-9; nonfunctional CED-3b. Active Bax and cytochrome c.,; nonfunctional caspase-9c. Inactive PI-3 kinase; active Bad
Answer Preview: a No cel…

, Chapter: 15 -Problem: 19 >> In Chapter 3, the Kd of calmodulin's EF hands for binding Ca2+ is given as - 10 6 M. Many proteins have much higher affinities for their respective ligands. Why is the specific affinity of calmodulin important for Ca2+ signaling processes such as that initiated by production of IP3?
Answer Preview: Prior to stimulation of the IP 3 DAG signaling pathwa…

, Chapter: 15 -Problem: 18 >> lnositoll,4,5-trisphosphate (IP1) and diacylglycerol (DAG) are second messenger molecules derived from the cleavage of the phosphatidylinositol 4,5-bisphosphate (PlP2) by activated phospholipase C. Describe the role of IP3 in causing a rise in cytosolic Ca2+ concentration. How do cells restore resting levels of cytosolic Cal2+? What is the principal function of DAG?
Answer Preview: Cleavage of PIP 2 by phospholipase C generates IP 3 and DAG IP …

, Chapter: 14 -Problem: 14 >> What mechanistic features are shared by(a) The formation of multivesicular endosomes by budding into the interior of the endosome and(b) The outward budding of HIV virus at the cell surface? You wish to design a peptide inhibitor/ competitor of HIV budding and decide to mimic in a synthetic peptide a portion of the HIV Gag protein. Which portion of the HIV Gag protein would be a logical choice? Wh
Answer Preview: In terms of membrane topology both the formation of multivesicular endosomes by budding into the int…

, Chapter: 14 -Problem: 10 >> 1-cell disease is a classic example of an inherited human defect in protein targeting that affects an entire class of proteins, soluble enzyme of the lysosome. What is the molecular defect in I-cell disease? Why does it affect the targeting of an entire class of proteins? What other types of mutations might produce the same phenotype?
Answer Preview: I cell disease is a particularly severe form of lysosomal storage disease Mul…

, Chapter: 4 -Problem: 11 >> What is the name given to the process that can repair DNA damage and generate genetic diversity? Briefly describe the similarities and differences of the two processes.
Answer Preview: Homologous recombination is the process that can repair DNA damage and also generate …

, Chapter: 21 -Problem: 9 >> Asymmetric cell division often relies on cytoskeletal elements to generate or maintain the asymmetric distribution of cellular factors. In S. cerevisiae, what factor is localized to the bud by myosin motors? ln Drosophila neuroblasts, what factors are localized apically by microtubules? Distribution The word "distribution" has several meanings in the financial world, most
Answer Preview: In S cerevisiae the myosin motor protein Myo4p …

, Chapter: 5 -Problem: 16 >> The ability to selectively modify the genome in the mouse has revolutionized mouse genetics. Outline the procedure for generating a knockout mouse at a specific genetic locus. How can the loxP-Cre system be used to conditionally knock out a gene? What is an important medical application of knockout mice?
Answer Preview: To generate a knockout mouse mouse embryonic stem cells are first transfected with a disru…

, Chapter: 14 -Problem: 5 >> Specificity in fusion between vesicles involves two discrete and sequential processes. Describe the first of the two processes and its regulation by GTPase switch proteins. What effect on the size of early endosomes might result from Over-expression of a mutant form of Rab5 that is stuck in the GTP-bound state?
Answer Preview: Vesicle fusion involves two stages first a docking stage mediated by long coiled coil proteins such …

, Chapter: 7 -Problem: 17 >> Recall that the Trp repressor binds to a site in the operator region of tryptophan-producing genes when tryptophan is abundant, thereby preventing transcription. What would happen to the expression of the tryptophan biosynthetic enzyme genes in the following scenarios? Fill in the blanks with one of the following phrases:never be expressed/always (constitutively) be expresseda. The cell produces a
Answer Preview: a Always be expre…

, Chapter: 14 -Problem: 2 >> Vesicle budding is associated with coat proteins. What is the role of coat proteins in vesicle budding? How are coat proteins recruited to membranes? What kinds of molecules are likely to be included or excluded from newly formed vesicles? What is the best-known example of a protein likely to be involved in vesicle pinching off?
Answer Preview: Coat proteins play two roles in vesicle budding 1 They provide a scaffold that establishes mem…

, Chapter: 5 -Problem: 5 >> Restriction enzymes and DNA ligase play essential roles in DNA cloning. How is it that a bacterium that produces a restriction enzyme does not cut its own DNA? Describe some general features of restriction-enzyme sites. What are the three types of DNA ends that can be generated after cutting DNA with restriction enzymes? What reaction is catalyzed by DNA ligase?
Answer Preview: Bacteria that synthesize restriction enzymes also synthesize a …

, Chapter: 14 -Problem: 7 >> What feature of procollagen synthesis provided early evidence for the Golgi cisternal maturation model?
Answer Preview: Procollagen subunits synthesized by ER associated …

, Chapter: 3 -Problem: 4 >> The following reaction coordinate diagram charts the energy of a substrate molecule (S) as it passes through a transition state (Xt) on its way to becoming a stable product (P) alone or in the presence of one of two different enzymes (El and E2). How does the addition of either enzyme affect the change in Gibb's free energy (?G) for the reaction? Which of the two enzymes binds with greater affinit
Answer Preview: The addition of enzyme does not affect the free energy of either the substrate or the product Th…

, Chapter: 13 -Problem: 13 >> The nuclear import of proteins larger than 40 kDa requires the presence of what amino acid sequence? Describe the mechanism of nuclear import. How are nuclear transport receptors able to get through the nuclear pore complex?
Answer Preview: The NLS The nuclear import receptor binds to the NLS on the cargo mol…

, Chapter: 2 -Problem: 12 >> The ?G0' for the reaction X + Y ? XY is -1000 cal/mol. What is the ?G at 25oC (298 Kelvin) starting with 0.01 M each X, Y, and XY? Suggest two ways one could make this reaction energetically favorable.
Answer Preview: The presence of one or more carbon carbon double bonds is indicative of an unsaturated o…

, Chapter: 13 -Problem: 3 >> Translocation into most organelles usually requires the activity of one or more cytosolic proteins. Describe the basic function of three different cytosolic factors required for translocation into the ER, mitochondria, and peroxisomes, respectively.
Answer Preview: SRP signal recognition particle acts as a cycling cytosolic factor for the translocation of ER targe…

, Chapter: 6 -Problem: 11 >> Describe the general organization of a eukaryotic chromosome. What structural role do scaffold-associated regions (SARs) or matrix attachment regions (MARs) play? Why does it make sense that protein-coding genes are not located in these regions?
Answer Preview: A eukaryotic chromosome consists of a long linear DNA molecule Th…

, Chapter: 22 -Problem: 14 >> Following the arrival of an action potential in stimulated cells, synaptic vesicles rapidly fuse with the presynaptic membrane. This happens in less than 1 ms. What mechanisms allow this process to take place at such great speed?
Answer Preview: Such rapid fusion of synaptic vesicles with plasma membrane in …

, Chapter: 22 -Problem: 18 >> Compare and contrast electrical and chemical synapses.
Answer Preview: Electrical Chemical Uni directional impulse transmission Bi …

, Chapter: 15 -Problem: 13 >> Both rhodopsin in vision and the muscarinic acetylcholine receptor system in cardiac muscle arc coupled to ion channels via G proteins. Describe the similarities and differences between these two systems.
Answer Preview: Activation of muscarinic acetylcholine receptors in cardiac muscle slows the rate of heart muscle co…

, Chapter: 3 -Problem: 6 >> Proteins are degraded in cells. What is ubiquitin, and what role does it play in tagging proteins for degradation? What is the role of proteasomes in protein degradation? How might proreasome inhibitors serve as chemotherapeutic (cancer-treating) agents?
Answer Preview: Ubiquitin is a 76amino acid protein that serves as a molecular tag for proteins destined for degrada…

, Chapter: 14 -Problem: 13 >> Describe how pH plays a key role in regulating the interaction between mannose 6-phosphate and the mannose 6-phosphate receptor. Why does elevating endosomal pH lead to the secretion of newly synthesized lysosomal enzymes into the extracellular medium?
Answer Preview: Within the endocytic pathway there is a progressive acidification increased hydrogen io…

, Chapter: 7 -Problem: 15 >> The yeast two-hybrid method is a powerful molecular genetic method to identify a protcin(s) that interacts with a known protein or protein domain. You have isolated the glucocorticoid receptor (GR) and have evidence that it is a modular protein containing an activation domain, a DNA binding domain, and a second ligand-binding activation domain. Further analysis reveals that in pituitary cells, the
Answer Preview: A two hybrid assay relies on unique yeast vectors one referred as the bait and the other the fish The bait vector contains sequence encoding a DNA bin…

, Chapter: 21 -Problem: 15 >> TNF and Fas ligand bind cell-surface receptors to trigger cell death. Although the death signal is generated external to the cell, why do we consider the death induced by these molecules to be apoptotic rather than necrotic?
Answer Preview: Although external signals such as TNF and Fas ligand induce apopto…

, Chapter: 2 -Problem: 16 >> The graph below illustrates the effect that the addition of a strong base such as sodium hydroxide has on the pH of an aqueous 0.1 M solution of an amino acid. Assume that prior to the addition of any OH-, the entire dissolved amino acid Sample is in its fully protonated form. The addition of OH- causes the expected steep increase in solution pH until, between roughly 0.03-0.07 M NaOH, the solutio
Answer Preview: When a weak acid is in aqueous solution of pH at or near its value of pK a the weak acid will quickl…

, Chapter: 21 -Problem: 4 >> Identify whether the following contain totipotent, pluripotent, or multipotent cells:(a) Inner cell mass(b) Morula,(c) Eight-cell embryo(d) Trophectoderm.
Answer Preview: a Pluripotent c…

, Chapter: 4 -Problem: 15 >> You have learned about the events surrounding DNA replication and the central dogma. Identify the steps associated with these processes that will be adversely affected in the following scenarios.a. Helicases unwind the DNA, but stabilizing proteins are mutated and cannot bind to the DNA.b. The mRNA molecule forms a hairpin loop on itself v1a complementary base pairing in an area spanning the AUG s
Answer Preview: a Double stranded DNA wont be unwound long enough to allo…

, Chapter: 15 -Problem: 23 >> cAMP is a second messenger that regulates many diverse cellular functions. In the intestinal lumen, cAMP is responsible for maintaining electrolyte and water balance. Certain bacterial toxins, including one produced by Vibrio cholera, can upset the levels of cAMP, leading to fatal dehydration.a. Given what you know about the mechanism of Vibrio cholera toxin, label the graph below showing cAMP con
Answer Preview: a cAMP concentration in normal intestinal epithelial cells rises and then falls whereas in cells …

, Chapter: 2 -Problem: 9 >> Ammonia (NH3) is a weak base that under acidic conditions becomes protonated to the ammonium ion in the following reaction:NH3 + H+ ? NH4+NH3 freely permeates biological membranes, including those of lysosomes. The lysosome is a sub-cellular organelle with a pH of about 4.5-5.0; the pH of cytoplasm is - 7.0. What is the effect on the pH of the fluid content of lysosomes when cells are exposed to a
Answer Preview: In the acidic pH of a lysosome ammonia is converted to ammonium ion Ammonium ion is …

, Chapter: 4 -Problem: 12 >> The genome of a retrovirus can integrate into the host-cell genome. What gene is unique to retroviruses, and why is the protein encoded by this gene absolutely necessary for maintaining the retroviral life cycle? A number of retroviruses can infect certain human cells. List two of them, briefly describe the medical implications resulting from these infections, and describe why only certain cells a
Answer Preview: The gene encoding the reverse transcriptase enzyme is …

, Chapter: 6 -Problem: 8 >> What are paralogous and orthologous genes? What are some of the explanations for the finding that humans are a much more complex organism than the roundworm C. elegans, yet have only fewer than one and a half as many genes (25,000 versus 18,000)?
Answer Preview: Paralogous genes are genes that have diverged as a result of a gene duplication i e two ge…

, Chapter: 5 -Problem: 3 >> Describe how complementation analysis can be used to reveal whether two mutations are in the same or in different genes. Explain why complementation analysis will not work with dominant mutations?
Answer Preview: Complementation analysis can be used to determine whether two r…

, Chapter: 13 -Problem: 4 >> Describe the typical principles used to identify topogenic sequences within proteins and how these can be used to develop computer algorithms. How does the identification of topogenic sequences lead to prediction of the membrane arrangement of a multipass protein? What is the importance of the arrangement of positive charges relative to the membrane orientation of a signal-anchor sequence?
Answer Preview: Many membrane proteins are embedded in the membrane by virtue of transmembrane a helical segment s S…

, Chapter: 4 -Problem: 13 >> a. Which of the following DNA strands, the top or bottom, would serve as a template for RNA transcription if the DNA molecule were to unwind in the indicated direction?5' ACGGACTGTACCGCTGAAGTCATGGACGCTCGA 3' 3 'TGCCTGACATGGCGACTTCAGT ACCTGCGAGCT 5'?Direction of DNA unwindingb. What would be the resulting RNA sequence (written 5' to 3')?
Answer Preview: a Bottom s…

, Chapter: 12 -Problem: 15 >> Write the overall reaction of oxygen-generating photosynthesis. Explain the following statement: the O2 generated by photosynthesis is simply a by-product of the pathway's generation of carbohydrates and ATP.
Answer Preview: 6CO 2 6H 2 O 6O 2 C 6 H 12 O 6 O 2 generating photosynth…

, Chapter: 3 -Problem: 1 >> The three-dimensional structure of a protein is determined by its primary, secondary, and tertiary structures. Define the primary, secondary, and tertiary structures. What are some of the common secondary structures? What are the forces that hold together the secondary and tertiary structures?
Answer Preview: The primary structure of a protein is the linear arrangement or sequence o…

, Chapter: 13 -Problem: 15 >> Imagine that you are evaluating the early steps in translocation and processing of the secretory protein prolactin. By using an experimental approach similar to that shown in Figure 13-7, you can use truncated prolactin mRNAs to control the length of nascent prolactin polypeptides that are synthesized. When prolactin mRNA that lacks a chain-termination (stop) codon is translated in vitro, the newl
Answer Preview: a Messenger RNA lengths vary by steps of 20 codons or 20 amino acids each in corresponding synthesized product When translated in the absence or prese…

, Chapter: 7 -Problem: 7 >> What is the difference between a promoter-proximal element and a distal enhancer? What are the similarities?
Answer Preview: Promoter proximal elements are located within 200 base pairs of …

, Chapter: 15 -Problem: 3 >> A child appears to be suffering from I-cell disease, but when a sample of his proteins (lane 3* below), isolated from skin fibroblasts, is compared to protein samples from fibroblasts of his healthy parents (lanes 1 and 2) and siblings (lanes 4€“6) using Western blot analysis and antibodies against N-acetylglucosamine phosphotransferase (~145 kDa) and actin (loading control, ~ 43 kDa), the followi
Answer Preview: a The drawn cell should show fluorescence in the RER and nowhere else The reason is th…

, Chapter: 7 -Problem: 2 >> The concentration of free glutamine affects transcription of the enzyme glutamine synthetase in E. coli. Describe the mechanism for this.
Answer Preview: Single or solitary genes are present once in the haploid genome In multicellu…

, Chapter: 14 -Problem: 12 >> What does the budding of influenza virus and vesicular stomatitis virus (VSV) from polarized MDCK cells reveal about the sorting of newly synthesized cell plasma membrane proteins to the apical or basolateral domains? Now consider the following result: A peptide with a sequence identical to that of the VSV G protein cytoplasmic domain inhibits targeting of the G protein to the basolateral surface
Answer Preview: In infected MDCK cells influenza viruses bud only from the apical membrane whereas …

, Chapter: 5 -Problem: 17 >> Two methods for functionally inactivating a gene without altering the gene sequence are by dominant-negative mutations and RNA interference (RNAi). Describe how each method can inhibit expression of a gene?
Answer Preview: A dominant negative mutation is a mutation that produces a mutant phenotype even in cells carr…

, Chapter: 21 -Problem: 7 >> Explain how hematopoietic stem cells were shown experimentally to be both pluripotent and capable of self-renewal.
Answer Preview: a cells secrete only a type mating ph…

, Chapter: 4 -Problem: 10 >> DNA-repair systems are responsible for maintaining genomic fidelity in normal cells despite the high frequency with which mutational events occur. What type of DNA mutation is generated by (a) UV irradiation (b) Ionizing radiation? Describe the system responsible for repairing each of these types of mutations in mammalian cells. Postulate why a loss of function in one or more DNA-repair systems ty
Answer Preview: a UV irradiation causes thymine thymine dimers These are usually repaired by the nucleotide excision …

, Chapter: 22 -Problem: 2 >> The resting potential of a neuron is -60 mV inside compared with outside the cell. How is the resting potential maintained in animal cells?
Answer Preview: The negative resting potential in animal cells is generated b…

, Chapter: 3 -Problem: 2 >> Proper folding of proteins is essential for their biological activity. In genetal, the functional conformation of a protein is the conformation with lowest energy. This means that if an unfolded protein is allowed to reach equilibrium, it should assemble automatically into its native, functioning folded state. Why then is there a need for molecular chaperones and chaperonins in cells? What differe
Answer Preview: Despite the fact that folded proteins adopt conformations that are ener…

, Chapter: 14 -Problem: 6 >> Sec18 is a yeast gene that encodes NSF. It is a class C mutant in the yeast secretory pathway. What is the mechanistic role of NSF in membrane trafficking? As indicated by its class C phenotype, why does an NSF mutation produce accumulation of vesicles at what appears to be only one stage of the secretory pathway?
Answer Preview: NSF through its ATPase activity catalyzes the dissociation of v SNARE …

, Chapter: 12 -Problem: 10 >> Describe the main functions of the different components of ATP synthase enzyme in the mitochondrion. A structurally similar enzyme is responsible for the acidification of lysosomes and endosomes. Given what you know about the mechanism of ATP synthesis, explain how this acidification might occur.
Answer Preview: ATP synthase is comprised of the F 0 and F 1 components F 0 is embedded in the …

, Chapter: 7 -Problem: 6 >> Describe the methods used to identify the location of DNA control elements in promoter proximal regions of genes.
Answer Preview: To identify DNA control elements within promoter regions …

, Chapter: 13 -Problem: 2 >> Describe the source or sources of energy needed for unidirectional translocation across the membrane in (a) Cotranslational translocation into the endoplasmic reticulum (ER);(b) Post-translational translocation into the ER; (c) Translocation into the mitochondrial matrix.
Answer Preview: a The energy source for cotranslational translocation comes from the translation process itself in o…

, Chapter: 5 -Problem: 6 >> Bacterial plasmids often serve as cloning vectors. Describe the essential features of a plasmid vector. What are the advantages and applications of plasmids as cloning vectors?
Answer Preview: A plasmid is a circula r extra chromosomal DNA molecule that contains an origin of repl…

, Chapter: 14 -Problem: 9 >> Clathrin adapter protein (AP) complexes bind directly to the cytosolic face of membrane proteins and also interact with clathrin. What are the four known adapter protein complexes? What observation regarding AP3 suggests that clathrin is an accessory protein to a core coat composed of adapter proteins?
Answer Preview: There are four known clathrin adapter protein complexes AP1 trans Go…

, Chapter: 6 -Problem: 2 >> Sequencing of the human genome has revealed much about the organization of genes. Describe the differences between solitary genes, gene families, pseudogenes, and tandemly repeated genes.
Answer Preview: Single or solitary genes are present once in the haploid genome In multicellu…

, Chapter: 21 -Problem: 1 >> What two properties define a stem cell? Distinguish between a totipotent stem cell, a pluripotent stem cell, and a precursor (progenitor) cell.
Answer Preview: By definition a stem cell divides to give rise to a copy of itself and to a differentia…

, Chapter: 4 -Problem: 16 >> Use the key provided below to determine the amino acid sequence of the polypeptide produced from the following DNA sequence. lntron sequences are highlighted. Note: Not all amino acids in the key will be used.5'TTCTAAACGCATGAAGCACCGTCTCAGAGCCAGTGA3'3'AAGATTTGCGTACTTCGTGGCAGAGTCTCGGTCACT5'†’Direction of DNA unwinding Transc
Answer Preview: RNA sequence 5 UUC UAC AUG AAG …

, Chapter: 15 -Problem: 12 >> The cholera toxin, produced by the bacterium Vibrio cholera, causes a watery diarrhea in infected individuals. What is the molecular basis for this effect of cholera toxin?
Answer Preview: Cholera toxin can penetrate the plasma membrane of c…

, Chapter: 6 -Problem: 14 >> Certain organisms contain cells that possess polytene chromosomes. What are polytene chromosomes, where are they found, and what function do they serve?
Answer Preview: Polytene chromosomes are present in larval salivary gla…

, Chapter: 22 -Problem: 15 >> Neurons, particularly those in the brain, receive multiple excitatory and inhibitory signals. What is the name of the extension of the neuron at which such signals are received? How does the neuron integrate these signals to determine whether or not to generate an action potential?
Answer Preview: The dendrite is the neuron extension that receives signals at synapses and the …

, Chapter: 20 -Problem: 1 >> Describe the two phenomena that give rise to the diversity of adhesive molecules such as cadherins. What additional phenomenon gives rise to the diversity of integrins?
Answer Preview: The diversity of adhesive molecules has arisen from 1 duplication of a common ances…

, Chapter: 4 -Problem: 17 >> a. Look at the figure below. Explain why it is necessary for Okazaki fragments to be formed as the lagging strand is produced (instead of a continuous strand).b. If the DNA polymerase in the figure above could only bind to the lower template strand, under what conditions(s) would it be able to produce a leading strand? Tr
Answer Preview: a Synthesis is from 5 3 as the DNA strand separates one …

, Chapter: 13 -Problem: 1 >> The following results were obtained in early studies on the translation of secretory proteins. Based on what we now know of this process, explain the reason why each result was observed. (a) An in vitro translation system consisting only of mRNA and ribosomes resulted in secretory proteins that were larger than the identical protein when translated in a cell. (b) A similar system that also include
Answer Preview: a In the absence of ER membranes the entire protein is trans…

, Chapter: 16 -Problem: 15 >> Why is the signaling pathway that activates NF-KB considered to be relatively irreversible compared with cytokine or RTK signaling pathways? Nonetheless, NF-KB signaling must be down-regulated eventually. How is the NF-KB signaling pathway turned off?
Answer Preview: The signaling pathway that activates NF kB is considered ir…

, Chapter: 5 -Problem: 15 >> Genetic linkage studies can usually only roughly locate the chromosomal position of a "disease" gene. How can expression analysis and DNA sequence analysis help locate a disease gene within the region identified by linkage mapping?
Answer Preview: Once a gene is roughly located along a chromosome by genetic linkage studies furt…

, Chapter: 21 -Problem: 17 >> How do lAPs (inhibitor of apoptosis proteins) interact with caspases to prevent apoptosis? How do mitochondrial proteins interact with lAPs to prevent inhibition of apoptosis?
Answer Preview: IAPs have zinc binding domains that can bind directl…

, Chapter: 17 -Problem: 5 >> The predominant forms of actin inside a cell are ATP-Gactin and ADP-F-actin. Explain how the interconversion of the nucleotide state is coupled to the assembly and disassembly of actin subunits. What would be the consequence for actin filament assembly/disassembly if a mutation prevented actin's ability to bind ATP? What would be the consequence if a mutation prevented actin's ability to hydrolyze
Answer Preview: ATPG actin assembles onto the ends of actin filaments and the …

, Chapter: 5 -Problem: 10 >> A number of foreign proteins have been expressed in bacterial and mammalian cells. Describe the essential features of a recombinant plasmid that are required for expression of a foreign gene. How can you modify the foreign protein to facilitate its purification? What is the advantage of expressing a protein in mammalian cells versus bacteria?
Answer Preview: In order to express a foreign gene a recombinant plasmid would require a promoter for efficient tr…

, Chapter: 15 -Problem: 20 >> Most of the short-term physiological responses of cells to cAMP are mediated by activation of PKA. cGMP is another common second messenger. What are the targets of cGMP in rod and smooth muscle cells?
Answer Preview: In rod cells cGMP opens ca…

, Chapter: 20 -Problem: 17 >> Researchers have isolated two E-cadherin mutant isoforms that are hypothesized to function differently from the isoform of the wild-type E-cadherin. An E-cadherin negative mammary carcinoma cell line was transfected with the mutant E-cadherin genes A (part a in the figure; triangles), or B (part b; triangles) or the wild-type E-cadherin gene (black circles) and compared to untransfected cells (ope
Answer Preview: a Cells transfected with wild type E cadherin aggregate more than untransfected cells because …

, Chapter: 5 -Problem: 13 >> DNA polymorphisms can be used as DNA markers. Describe the d1fferences between SNP and SSR polymorphisms. How can these markers be used for DNA-mapping studies?
Answer Preview: Single nucleotide polymorphisms SNPs are changes in a single nucleo…

, Chapter: 21 -Problem: 8 >> The roundworm C. elegans has proved to be a valuable model organism for studies of cell birth, cell asymmetry, and cell death. What properties of C. elegans render it so well suited for these studies? Why is so much information from C. elegans experiments of use to investigators interested in mammalian development?
Answer Preview: Because C elegans consists of a small invariant number of cells …

, Chapter: 17 -Problem: 10 >> There are at least 20 different types of myosin. What properties do all types share, and what makes them different? Why is myosin II the only myosin capable of producing contractile force?
Answer Preview: All myosins use energy derived from ATP hydrolysis to walk along actin filaments Depen…

, Chapter: 6 -Problem: 9 >> The DNA in a cell associates with proteins to form chromatin. What is a nucleosome? What role do histones play in nucleosomes? How are nucleosomes arranged in condensed 30-nm fibers?
Answer Preview: A nucleosome consists of a protein core of histone…

, Chapter: 19 -Problem: 13 >> In 2001, the Nobel Prize in Physiology or Medicine was awarded to three cell-cycle scientists. Paul Nurse was recognized for his studies with the fission yeast S. pombe, in particular for the discovery and characterization of the wee1+ gene. What did the characterization of the wee 1 gene tell us about cell cycle control?
Answer Preview: The wee phenotype in S pombe displays smaller than usual cells Premature entry into mitosis be…

, Chapter: 6 -Problem: 17 >> To determine whether gene transfer from an organelle genome to the nucleus can be observed in the laboratory, a chloroplast transformation vector was constructed that contained two selectable antibiotic-resistance markers, each with its own promoter: the spectinomycin-resistance gene and the kanamycin-resistance gene (see S. Stegemann et al., 2003, Proc. Nat'/ Acad. Sci. USA 100:8828-8833). The sp
Answer Preview: a If the kanamycin resistance gene were localized solely in the chloroplast DNA of leaf cells of the spectinomycin resistant plants no kanamycin resis…

, Chapter: 17 -Problem: 15 >> Contraction of both skeletal and smooth muscle is triggered by an increase in cytosolic Ca2+. Compare the mechanisms by which each type of muscle converts a rise in Ca2+ into contraction.
Answer Preview: The mechanism by which a rise in Ca 2 triggers contract…

, Chapter: 6 -Problem: 16 >> Describe the problem that occurs during DNA replication at the ends of chromosomes. How are telomeres related to this problem?
Answer Preview: Because DNA polymerase is unable to initiate synthesis of a nucleotide strand …

, Chapter: 18 -Problem: 3 >> In cells, microtubule assembly depends on other proteins as well as tubulin concentration and temperature. What types of proteins influence microtubule assembly in vivo, and how does each type affect assembly?
Answer Preview: The best understood proteins involved in regulating microtubule assembly are the stabili…

, Chapter: 7 -Problem: 3 >> What types of genes are transcribed by RNA polymcrases I, II, and III? Design an experiment to determine whether a specific gene is transcribed by RNA polymerase II.
Answer Preview: RNA polymerase I is responsible for transcribing 18S a…

, Chapter: 16 -Problem: 16 >> Describe two roles for polyubiquitination in the NK-KB signaling pathway.
Answer Preview: Stimulation of a cell by an infectious agent or inf…

, Chapter: 5 -Problem: 1 >> Genetic mutations can provide insights into the mechanisms of complex cellular or developmental processes. How might your analysis of a genetic mutation be different depending on whether a particular mutation is recessive or dominant?
Answer Preview: A recessive mutation must be present in both alleles of a diploid organism in order for the m…

, Chapter: 19 -Problem: 3 >> Tim Hunt shared the 2001 Nobel Prize in Physiology or Medicine for his work in the discovery and characterization of cyclin proteins in eggs and embryos. Describe the experimental steps that led him to his discovery of cyclins?
Answer Preview: Hunt and colleagues used a variety of marine invertebrate cell culture …

, Chapter: 7 -Problem: 4 >> The CTD of the largest subunit of RNA polymerase II can be phosphorylated at multiple serine residues. What are the conditions that lead to the phosphorylated versus unphosphorylated RNA polymerase II CTD?
Answer Preview: The CTD becomes phosphorylated by a subunit …

, Chapter: 17 -Problem: 1 >> Three systems of cytoskeletal filaments exist in most eukaryotic cells. Compare them in terms of composition, function, and structure.
Answer Preview: Actin filaments microfi laments are composed of monomeric actin protein s…

, Chapter: 3 -Problem: 10 >> Various methods have been developed for detecting proteins. Describe how radioisotopes and autoradiography can be used for labeling and detecting proteins. How does Western blotting detect proteins?
Answer Preview: Proteins can be made radioactive by the incorporation of radioactively labeled amino acids during pr…

, Chapter: 20 -Problem: 12 >> Blood clotting is a crucial function for mammalian survival. How do the multi-adhesive properties of fibronectin lead to the recruitment of platelets to blood clots?
Answer Preview: Fibronectin contains RGD and fibrin b…

, Chapter: 4 -Problem: 9 >> Eukaryotes have repair systems that prevent mutations due to copying errors and exposure to mutagens. What are the three excision-repair systems found in eukaryotes, and which one is responsible for correcting thymine-thymine dimmers that form as a result of UV light damage to DNA?
Answer Preview: Base excision repair is responsible for repairing …

, Chapter: 19 -Problem: 4 >> What experimental evidence indicates that cyclin B is required for a cell to enter mitosis? What evidence indicates that cyclin B must be destroyed for a cell to exit mitosis?
Answer Preview: Murray and Kirschner performed a classic set of experiments in frog egg answes to reveal the …

, Chapter: 2 -Problem: 11 >> What is the ionization state of phosphoric acid in the cytoplasm? Why is phosphoric acid such a physiologically important compound?
Answer Preview: G G RTln products reactants For this reaction G 1000 cal mol 1 987 cal degree mol 298 …

, Chapter: 16 -Problem: 19 >> 1. G. Johnson and colleagues have analyzed the MAP kinase cascade in which MEKK2 participates in mammalian cells. By a yeast two-hybrid screen (see Chapter 7), MEKK2 was found to bind MEK5, which can phosphorylate a MAP kinase. To elucidate the signaling pathway transduced by MEKK2 in vivo, the following studies were performed in human embryonic kidney (HEK293) cells in culture.a. HEK293 cells wer
Answer Preview: 1 a This experiment reveals that MEK5 and MEKK2 co localize within a complex because immunoprecipitation with a MEK5 antibody also precipitates MEKK2 …

, Chapter: 5 -Problem: 8 >> In 1993, Ka'ry Mullis won the Nobel Prize in Chemistry for his invention of the PCR process. Describe the three steps in each cycle of a PCR reaction. Why was the discovery of a thermostable DNA polymerase (e.g., Taq polymerase) so important for the development of PCR?
Answer Preview: The PCR reaction is performed as multiple cycles of a three step process The fir…

, Chapter: 3 -Problem: 3 >> Enzymes catalyze chemical reactions. What constitutes the active sire of an enzyme? What are the turnover number (kcat), the Michaelis constant (K111), and the maximal velocity ( Vmax,) of an enzyme? The kcat for carbonic anhydrase is 5 X 105molecules/s. This is a "rate constant" bur nor a "rate." What is the difference? By what concentration would you multiply this rate constant in order to deter
Answer Preview: The active site of an enzyme is the region within which the substrate binds and is converted into pr…

, Chapter: 3 -Problem: 8 >> A number of techniques can separate proteins on the basis of their differences in mass. Describe the use of two of these techniques, centrifugation and gel electrophoresis. The blood proteins transferrin (MW 76 kDa) and lysozyme (MW 15 kDa) can be separated by rate-zonal centrifugation or SDS-polyacrylamide gel electrophoresis. Which of the two proteins will sediment faster during centrifugation?
Answer Preview: Proteins can be separated by mass by centrifuging them through a solution of increasing density …

, Chapter: 12 -Problem: 8 >> The electron transport chain consists of a number of multiprotein complexes, which work in conjunction to pass electrons from an electron carrier, like NADH, to O2. What is the role of these complexes in ATP synthesis? It has been demonstrated that respiration supercomplexes contain all the protein components necessary for respiration. Why is this beneficial for ATP synthesis, and what is one way
Answer Preview: The multiprotein complexes in the electron transport chain pass electrons between prot…

, Chapter: 9 -Problem: 8 >> Hoechst 33258 is a chemical dye that binds specifically to DNA in live cells, and when excited by UV light, it fluoresces in the visible spectrum. Name and describe one specific method, employing Hoechst 33258, an investigator would use to isolate fibroblasts in the G2 phase of the cell cycle from those fibroblasts in interphase.
Answer Preview: FACS whereby labeled cells pass through a laser light beam and the fluorescent intens…

, Chapter: 2 -Problem: 10 >> Consider the binding reaction L + R ? LR, where L is a ligand and R is its receptor. When 1 X 10-3 M L is added to a solution containing 5 X 10-2 M R, 90 percent of the L binds to form LR. What is the K cq of this reaction? How will the Keq be affected by the addition of a protein that facilitates (catalyzes) this binding reaction? What is the dissociation equilibrium constant Kd?
Answer Preview: K eq LR L R Since 90 of L binds R the concentration of LR at equilibrium is 0 9 …

, Chapter: 2 -Problem: 1 >> The gecko is a reptile with an amazing ability to climb smooth surfaces, including glass. Recent discoveries indicate that geckos stick to smooth surfaces via van der Waals interactions between septae on their feet and the smooth surface. How is this method of stickiness advantageous over covalent interactions? Given that van der Waals forces are among the weakest molecular interactions, how can t
Answer Preview: Less energy is required to form non covalent bonds than covalent bonds and t…

, Chapter: 4 -Problem: 4 >> What are the major differences in the synthesis and structure of prokaryotic and eukaryotic mRNAs?
Answer Preview: In prokaryotes many protein coding genes are clustered in operons where tra…

, Chapter: 11 -Problem: 12 >> Patch clamping can be used to measure the conductance properties of individual ion channels. Describe how patch clamping can be used to determine whether or not the gene coding for a putative K+ channel actually codes for a K+ or Na+ channel.
Answer Preview: Expression of a channel protein in a normally nonexpressin…

, Chapter: 4 -Problem: 6 >> The transcription of many bacterial genes relies on functional groups called operons, such as the tryptophan operon. What is an operon? What advantages are there to having genes arranged in an operon, compared with the arrangement in eubaryotes?
Answer Preview: An operon is an arrangement of genes in a functional group that are devoted to a single …

, Chapter: 12 -Problem: 3 >> Maximal production of ATP from glucose involves the reactions of glycolysis, the citric acid cycle, and the electron transport chain. Which of these reactions requires O2, and why? Which, in certain organisms or physiological conditions, can proceed in the absence of O2?
Answer Preview: Glycolysis does not require oxygen but the citric acid cycl…

, Chapter: 6 -Problem: 13 >> What is chromosome painting, and how is this technique useful? How can chromosome paint probes be used to analyze the evolution of mammalian chromosomes?
Answer Preview: Metaphase chromosomes can be identified by size shape banding pa…

, Chapter: 12 -Problem: 13 >> The Q cycle plays a major role in the electron transport chain of mitochondria, chloroplasts, and bacteria. What is the function of the Q cycle, and how does it carry out this function? What electron transport components participate in the Q cycle in mitochondria, in purple bacteria, and in chloroplasts?
Answer Preview: The Q cycle functions to double the number of protons transported per electron pair moving through a …

, Chapter: 18 -Problem: 2 >> Microtubules both in vitro and in vivo undergo dynamic instability, and this type of assembly is thought to be intrinsic to the microtubule. What is the current model that accounts for dynamic instability?
Answer Preview: During dynamic instability microtubules alternate between growth and shortening The …

, Chapter: 10 -Problem: 11 >> What is the likely identity of these membrane-associated proteins: (a) Released from the membrane with a high-salt solution causing disruption of ionic linkages; (b) Not released from the membrane upon exposure to a high-salt solution alone, but released when incubated with an enzyme that cleaves phosphate-glycerol bonds and covalent linkages are disrupted; (c) Not released from the membrane upon
Answer Preview: a Peripheral b Lipid anc…

, Chapter: 2 -Problem: 13 >> According to health experts, saturated fatty acids, which come from animal fats, are a major factor contributing to coronary heart disease. What distinguishes a saturated fatty acid from an unsaturated fatty acid, and to what does the term saturated refer? Recently, trans unsaturated fatty acids, or trans fats, which raise total cholesterol levels in the body, have also been implicated in heart di
Answer Preview: Glutamate is the amino acid that undergoes carboxyla…

, Chapter: 18 -Problem: 14 >> The poleward movement of kinetochores, and hence chromatids, during anaphase A requires that kinetochores maintain a hold on the shortening microtubules. How does a kinetochore hold on to shortening microtubules?
Answer Preview: Inhibition of kinesin 5 would be expected to have a number of effects Fi…

, Chapter: 10 -Problem: 9 >> Although both faces of a biomembranc are composed of the same general types of macromolecules, principally lipids and proteins, the two faces of the bilayer are not identical. What accounts for the asymmetry between the two faces?
Answer Preview: Since biomembranes form closed compartments one face of the bilayer is a…

, Chapter: 6 -Problem: 4 >> Mobile DNA elements that can move or transpose to a new site directly as DNA are called DNA transposons. Describe the mechanism by which a bacterial DNA transposon, called an insertion sequence, can transpose.
Answer Preview: A bacterial insertion sequence or IS element is a member of the class of …

, Chapter: 17 -Problem: 20 >> Myosin Vis an abundant nonmuscle myosin that is responsible for the transport of cargo such as organelles in many cell types. Structurally, it consists of two identical polypeptide chains that dimerize to form a homodimer. The motor domains reside at theN-terminus of each chain and contain both ATP- and actin-binding sites. The motor domain is followed by a neck region containing six "IQ" motifs,
Answer Preview: a These data show that myosin V has low ATPase activity when the free Ca 2 is below 1 micromolar Thu…

, Chapter: 2 -Problem: 7 >> The chemical basis of blood-group specificity resides in the carbohydrates displayed on the surface of red blood cells. Carbohydrates have the potential for great structural diversity. Indeed, the structural complexity of the oligosaccharides that can be formed from four sugars is greater than that for oligopeptides from four amino acids. What properties of carbohydrates make this great structural
Answer Preview: At least three properties contribute to this structura…

, Chapter: 17 -Problem: 6 >> Actin filaments at the leading edge of a crawling cell are believed to undergo treadmilling. What is treadmilling, and what accounts for this assembly behavior?
Answer Preview: Treadmilling is a form of actin filament assembly that oc…

, Chapter: 6 -Problem: 18 >> Satellite DNA is a known component of our genome and can be found in both coding and noncoding DNA. When it is found in coding DNA, the number of repeats can result in altered proteins. Bur the effect of these repeats in noncoding DNA is nor as well understood. To determine whether repeats in the promoter region can alter gene expression and chromatin compaction, Vinces et al. (Vinces et al., 2009
Answer Preview: a Slippage between the daughter and template strand during replication can result in an increase in …

, Chapter: 17 -Problem: 9 >> Compare and contrast the ways in which formin and WASp arc activated, and how each stimulates actin filament formation.
Answer Preview: Both formin and WASp are self inhibited by intramolecular interacti…

, Chapter: 7 -Problem: 11 >> Using CREB and nuclear receptors as examples, compare and contrast the structural changes that take place when these transcription factors bind to their co-activators.
Answer Preview: CREB binding to its co activator CBP is regulated by cAMP which stimulates phosphorylation of CRE…

, Chapter: 16 -Problem: 1 >> Name three features common to the activation of cytokine receptors and receptor tyrosine kinases. Name one difference with respect to the enzymatic activity of these receptors.
Answer Preview: Both cytokine receptors and receptor tyrosine kinases RTKs form function…

, Chapter: 6 -Problem: 7 >> Mitochondria and chloroplasts are thought to have evolved from symbiotic bacteria present in nucleated cells. What is the experimental evidence from this chapter that supports this hypothesis?
Answer Preview: Similarities between bacteria mitochondria and chloroplasts reflect the proposed endosymbiotic origi…

, Chapter: 17 -Problem: 19 >> Cell motility has been described as being like the motion of tank treads. At the leading edge, actin filaments form rapidly into bundles and networks that make protrusions and move the cell forward. At the rear, cell attachments are broken and the tail end of the cell is brought forward. What provides the traction for moving cells? How does cell-body translocation happen? How are cell attachments
Answer Preview: Traction in cell motility is provided by focal adhesions At foc…

, Chapter: 7 -Problem: 9 >> Describe the structural features of transcriptional activator and repressor proteins.
Answer Preview: Transcriptional activators and repressors con…

, Chapter: 20 -Problem: 14 >> How do changes in molecular connections between the extracellular matrix (ECM) and cytoskeleton give rise to Duchenne muscular dystrophy?
Answer Preview: The process is called extravasation Inflammatory signals including chemokines are rele…

, Chapter: 2 -Problem: 8 >> Calculate the pH of 1 L of pure water at equilibrium. How will the pH change after 0.008 moles of the strong base NaOH are dissolved in the water? Now, calculate the pH of a 50 mM aqueous solution of the weak acid 3-(N-morpholino) propane- 1-sulfonic acid (MOPS) in which 61% of the solute is in its weak acid form and 39% is in the form of MOPS conjugate base (the pK3 for MOPS is 7.20). What is the
Answer Preview: What is the pH of 1 L of water In all aqueous solutions water spontaneously dissociates into hydrogen and hydroxide ions according to the equilibrium …

, Chapter: 16 -Problem: 8 >> Describe the events required for full activation of protein kinase B. Name two effects of insulin mediated by protein kinase B in muscle cells.
Answer Preview: Maximal activation of protein kinase B requires 1 Release of inhibition by its own PH d…

, Chapter: 4 -Problem: 3 >> What difference between RNA and DNA helps to explain the greater stability of DNA? What implications does this have for the function of DNA?
Answer Preview: RNA is less stable chemically than DNA because of the presence of a …

, Chapter: 16 -Problem: 17 >> What feature of Delta ensures that only neighboring cells are signaled?
Answer Preview: Delta is a single pass plasma membrane protein with an extracellula…

, Chapter: 5 -Problem: 7 >> A DNA library is a collection of clones, each containing a different fragment of DNA, inserted into a cloning vector. What is the difference between a eDNA and a genomic DNA library? You would like to clone gene X, a gene expressed only in neurons, into a vector using a library as the source of insert. If you have the following libraries at your disposal (genomic library from skin cells, eDNA libr
Answer Preview: DNA libraries are collections of randomly cloned DNA fragments A cDNA compl…

, Chapter: 18 -Problem: 1 >> Microtuhules are polar filaments; that is, one end is different from the other. What is the basis for this polarity, how is polarity related to microtubule organization within the cell, and how is polarity related to the intracellular movements powered by microtubule-dependent motors?
Answer Preview: The basis of microtubule polarity is the head to tail a…

, Chapter: 2 -Problem: 5 >> In the 1960s, the drug thalidomide was prescribed to pregnant women to treat morning sickness. However, thalidomide caused severe limb defects in the children of some women who took the drug, and its use for morning sickness was discontinued. It is now known that thalidomide was administered as a mixture of two stereoisomeric compounds, one of which relieved morning sickness and the other of which
Answer Preview: Stereoisomers are compounds that have the same molecular f…

, Chapter: 18 -Problem: 7 >> Certain cellular components appear to move bidirectionally on microtubules. Describe how this is possible given that microtubule orientation is fixed by the MTOC.
Answer Preview: Although microtubule orientation is fixed by the MTOC and a…

, Chapter: 6 -Problem: 12 >> What is FISH? Briefly describe how it works. How is FISH used to characterize chromosomal translocations associated with certain genetic disorders and specific types of cancers?
Answer Preview: FISH or fluorescent in situ hybridization is one of many related techniques used to detect DNA or RN…

, Chapter: 12 -Problem: 11 >> Much of our understanding of ATP synthase is derived from research on aerobic bacteria. What makes these organisms useful for this research? Where do the reactions of glycolysis, the citric acid cycle, and the electron transport chain occur in these organisms? Where is the pmf generated in aerobic bacteria? What other cellular processes depend on the pmf in these organisms?
Answer Preview: Aerobic bacteria carry out oxidative phosphorylation by …

, Chapter: 17 -Problem: 12 >> Contractile bundles occur in nonmuscle cells; these structures are less organized than the sarcomeres of muscle cells. What is the purpose of nonmuscle contractile bundles? Which type of myosin is found in contractile bundles?
Answer Preview: The principal contractile bundles of nonmuscle cel…

, Chapter: 3 -Problem: 14 >> Proteomics involves the global analysis of protein expression. In one approach, all the proteins in control cells and treated cells are extracted and subsequently separated using two-dimensional gel electrophoresis. Typically, hundreds or thousands of protein spots are resolved and the steady-state levels of each protein are compared between control and treated cells. In the following example, onl
Answer Preview: a Proteins 3 5 6 and 7 do not change in response to the drug Protein 1 declines in response to the d…

, Chapter: 22 -Problem: 17 >> What is the role of dynamin in recycling synaptic vesicles? What evidence supports this?
Answer Preview: Dynamin is a GTP binding protein that is required …

, Chapter: 5 -Problem: 4 >> Jane has isolated a mutant strain of yeast that forms red colonies instead of the normal white when grown on a plate. To determine the mutant gene, she decides to use functional complementation with a DNA library containing a lysine selection marker. lu addition to the unknown gene mutation, the yeast are lacking the gene required to synthesize the amino acids leucine and lysine. What media will J
Answer Preview: She will grow them on media without lysine These yeast c…

, Chapter: 20 -Problem: 15 >> The structure of a plant cell wall needs to loosen to accommodate cell growth. What signaling molecule controls this process?
Answer Preview: Small molecule hormones called aux…

, Chapter: 2 -Problem: 6 >> Name the compound shown below. Is this nucleotide a component of DNA, RNA, or both? Name one other function of this compound. Transcribed Image Text: IN HN, E 8CH 9, N. 'N. ?,N 5" -0-P-0-0-P-0-0-P-0 — ??, ? ? ? ? 2" ?? ?? ?
Answer Preview: The compound is guanosine triphosphate GTP Althoug…

, Chapter: 20 -Problem: 8 >> Compare the functions and properties of each of three types of macromolecules that are abundant in the extracellular matrix of all tissues?
Answer Preview: Proteoglycans are highly viscous glycoproteins that cushion cells and …

, Chapter: 6 -Problem: 15 >> Replication and segregation of eukaryotic chromosomes require three functional elements: replication origins, a centromere, and telomeres. How would a chromosome be affected if it lacked (a) Replication origins (b) A centromere?
Answer Preview: Replication origins are the points at which DNA synthes…

, Chapter: 20 -Problem: 6 >> What is collagen, and how is it synthesized? How do we know that collagen is required for tissue integrity?
Answer Preview: Collagen is a major component of the extracellular matrix in animal cells It is a pr…

, Chapter: